Likao Bearing Co., Ltd.
Likao Bearing Co., Ltd.
FAG Bearing   Timken Bearing   NTN Bearing  
  • Home
  • Product Categories
    • FAG Bearing
    • Timken Bearing
    • NTN Bearing
    • KOYO Bearing
    • ISO Bearing
    • NACHI Bearing
    • NSK Bearing
    • INA Bearing
    • CYSD Bearing
    • FBJ Bearing
    • 608rs Bearing
    • 6202 Bearing
    • Abec 5 Bearings
    • bb30 Bearings
  • Company Profile
    • Company Introduction
  • Technical Articles
  • Contact Us

Home>Products>CYSD Bearing>110 mm x 170 mm x 47 mm CYSD 33022 tapered roller bearings

English
English
  • 110 mm x 170 mm x 47 mm  CYSD 33022 tapered roller bearings
  • 110 mm x 170 mm x 47 mm  CYSD 33022 tapered roller bearings
  • 110 mm x 170 mm x 47 mm  CYSD 33022 tapered roller bearings
  • 110 mm x 170 mm x 47 mm  CYSD 33022 tapered roller bearings

110 mm x 170 mm x 47 mm CYSD 33022 tapered roller bearings

  • Manufacturers of all CYSD Bearing 48.4 mm B1 are represented -20 °C T min. in our partial list of clients. Contact Gary for Likao Bearing Co., Ltd. a complete 110 mm x 170 mm x 47 mm CYSD 33022 tapered roller bearings 110 mm x 170 mm x 47 mm list of clients and projects.

  • CYSD
  • 33022

  • 29.2 kN
  • 48.4 mm
  • -20 °C
  • 35 mm
  • 125 mm
  • 200 °C
  • 2.5 mm
  • M6x1
Contact NowWhatsApp
Likao Bearing Co., Ltd.

Likao Bearing Co., Ltd.China

  • Likao Bearing Co., Ltd.2020-07-10 09:46:19
    Welcome to my shop! Glad to serve you! Please send your question!
Price Inspection Certificate Product Specifications Company Profile

Product Details

C0: 29.2 kN B1: 48.4 mm T min.: -20 °C
A: 35 mm H: 125 mm T max.: 200 °C
A3: 2.5 mm G: M6x1 d: 55 mm
Designation of bearing: ES211G2T20 Size (mm): 110 mm x 170 mm x 47 mm
110 mm x 170 mm x 47 mm CYSD 33022 tapered roller bearings pdf

Product Description

e22 mm
Z57.7 mm
GM6x1
H181 mm
d45 mm
s120.6 mm
A38 mm
L108 mm
J148 mm
Dz95 mm

Searches related to 110 mm x 170 mm x 47 mm CYSD 33022 tapered roller bearings Online Free check


  • CYSD 6808-2RZ deep groove ball bearings

    Recommended tightening torque for set screw:5.5 Nm; L:126.5 mm; A:32 mm; T min.:-20 °C; N:11mm; C:12.8 kN; Designation of housing:PLE204N-; d:20 mm; H2:63.7 mm; Weight:0.6 kg;
    Read More ...
  • CYSD NU306E cylindrical roller bearings

    B:25 mm; Brand:NTN; f0:13.1; Fatigue limit load, Cu:1.45 kN; Static load, C0:32 kN; Nlim (grease):7,000 rpm; Min operating temperature, Tmin:-20 °C; Characteristic outer ring frequency, BPF0:3.06 Hz; rs min:1.5 mm; Characteristic inner ring frequency, BPFI:4.94 Hz;
    Read More ...
  • CYSD 7919CDF angular contact ball bearings

    Recommended tightening torque for set screw:8 Nm; S:10.9 mm; A:40 mm; s1:21.75 mm; A5:32.6 mm; G1:M24; E:24 mm; SW:3.97 mm; Weight:1.78 kg; G:R1/8";
    Read More ...
  • CYSD W6304-2RS deep groove ball bearings

    C:35.1 kN; E:20 mm; J:101.6 mm; S:24.6 mm; N:M16; d:50 mm; T min.:-20 °C; A:54 mm; C0:23.2 kN; T max.:100 °C;
    Read More ...
  • CYSD 7944DT angular contact ball bearings

    C:11 mm; Lw:6.3 mm; Category:Bearings; Cr:4.75 kN; Minimum Buy Quantity:N/A; d1:8 mm; Dw:1.5 mm; Characteristic inner ring frequency, BPFI:8.48 Hz; Mass:0.03 kg; Product Group:B04120;
    Read More ...
  • CYSD 7816CDB angular contact ball bearings

    L:175 mm; Designation of housing:FE212N-; Designation of bearing:EX212G2; d1:82 mm; A:53.5 mm; Weight:5.37 kg; S:30.9 mm; T max.:100 °C; s1:53.2 mm; G:R1/8";
    Read More ...
  • CYSD 6908N deep groove ball bearings

    Designation of bearing:UC217-52G2T04; s1:42.85 mm; T min.:-40 °C; C:83.2 kN; S:34.1 mm; d:82.55 mm; Weight:3.32 kg; B:85.7 mm; C0:63.8 kN; A5:51.6 mm;
    Read More ...
  • CYSD 6226 deep groove ball bearings

    A:25.5 mm; J:78 mm; Designation of housing:FC204N-; B:34 mm; Designation of bearing:EX201G2; e:10 mm; B1:43.5 mm; H3:62; d:12 mm; A2:36.5 mm;
    Read More ...
  • CYSD 6916-RS deep groove ball bearings

    A2:40.2 mm; s1:19.05 mm; S:15.9 mm; Designation of housing:F206N-; L:108 mm; C0:11.2 kN; d:30.16 mm; N:12mm; A1:13 mm; G:M6x1;
    Read More ...
  • CYSD 6905-2RS deep groove ball bearings

    Designation of open end cover:SCOE204-12; Z:62.9 mm; H2:64 mm; B1:43.5 mm; C:12.8 kN; T min.:-20 °C; L1:18 mm; d:12 mm; Weight:0.63 kg; L:65 mm;
    Read More ...
  • CYSD NUP416 cylindrical roller bearings

    L1:76 mm; d:25.4 mm; N:26mm; H2:62 mm; SW:3.18 mm; C0:11.5 kN; N2:36 mm; S:15 mm; B:38 mm; G:M6x1;
    Read More ...
  • CYSD 7906C angular contact ball bearings

    d:50 mm; C:35.1 kN; T min.:-20 °C; G:R1/8"; A1:34 mm; N:M16; S:10.9 mm; B:43.5 mm; A:54 mm; J:101.6 mm;
    Read More ...
  • CYSD NUP221 cylindrical roller bearings

    H1:14 mm; T min.:-20 °C; Designation of bearing:US204G2; S:7 mm; T max.:100 °C; Recommended tightening torque for set screw:5.5 Nm; A:38 mm; B:25 mm; H2:64 mm; Designation of housing:PG204-;
    Read More ...
  • CYSD 8608 deep groove ball bearings

    C:62 kN; e:38 mm; G:R1/8"; Designation of bearing:EX214-43G2; d:68.26 mm; s1:57.6 mm; N:18mm; d1:96.8 mm; Designation of housing:FE214-; T max.:100 °C;
    Read More ...
  • CYSD 6213-RS deep groove ball bearings

    d1:74.5 mm; S:27.7 mm; T min.:-20 °C; A:43 mm; e:25 mm; Designation of housing:F211N-; C:43.55 kN; B:55.4 mm; B1:71.3 mm; T max.:100 °C;
    Read More ...

 

Ready to Ship CYSD Bearing
TFDrLmJS
6213-RS - - - - - - - 27.7 mm
7919CDF - - - - - - - 10.9 mm
6908N - - - - - - - 34.1 mm
8608 - - - - - - - -
7944DT - - - - - - - -
NUP416 - - - - - - - 15 mm
W6304-2RS - - - - - - 101.6 mm24.6 mm
6916-RS - - - - 108 mm - - 15.9 mm
NU306E - - - - - - - -
6808-2RZ - - - - 126.5 mm - - -
NUP221 - - - - - - - 7 mm
6226 - - - - - - 78 mm -
7906C - - - - - - 101.6 mm10.9 mm
7816CDB - - - - 175 mm - - 30.9 mm
6905-2RS - - - - 65 mm - - -
6915-2RZ - - - - - - - 34.1 mm
7232DT - - - - 94 mm - 130 mm8.5 mm
32009 - - - - 85 mm - 60 mm -
7021C - - - - - - 137.5 mm -
6003-ZZ - - - - - - 119 mm -
33030 - - 40 mm - - - - -
6322-2RS - - - - - - - -
6024 - - - - - - - -
6936-2RZ - - - - - - - -
NUP209E - - - - - - - 6 mm
NJ317E - - - - - - 117 mm -
NU310E - - 110 mm - - - - -
320/22 - - - - - - - -
6910NR - - - - 178 mm - - 22 mm
NU424 - - 80 mm - - - - -
6914-RZ - - - - - - - -
6004-RS - - - - - - - 24.6 mm
32920 - - - - - - - -
6809NR - - - - 105 mm - - -
7210CDF - - - - 108 mm - 148 mm -
W208PP5 - - - - - - - -
7232BDF - - - - - - - -
7214C - - 30 mm - - - - -
3211 - - 120 mm1.5 - 12 mm - 25.4 mm
7028DT - - - - 95 mm - - 14.3 mm
7017CDT - - - - - - - -
6232-2RS - - - - - - - -
7226B - - - - - 14 mm - 32 mm
6811-2RZ - - - - 115 mm - - 14.3 mm
NU2208E - - - - - - - 17.5 mm
7811C - - - - - - - -
32934*2 - - - - - - - 17 mm
7311CDB - - - - - - - -
NUP211E - - - - - - - 12.7 mm
7818CDT - - - - - - - -
7012 - - - - - - - -
6944-2RZ - - - - - - - -
6002 - - - - 320 mm - - -
206KRR6 - - - - 94 mm - - 12.7 mm
32910 - - - - - - - 18.2 mm
1635-2RS - - - - - - - -
6804-ZZ - - - - - - - 30.9 mm
32221 - - - - - - - -
W6309-ZZ - - - - - - - 33 mm
7812CDF - - - - - - 232 mm -
W208PPB2 - - - - - 380 mm - -
32918 - - - - 60 mm - 90 mm17 mm
7300B - - - - - - 203 mm -
NU2224 - - - - - - 121 mm8 mm
NJ304+HJ304 - - - - 140 mm - - 14.9 mm
30206 - - - - 100 mm - 78 mm -
NU238 - - - - - - - 1 mm
7201BDB - 48.5 mm - - - - - -
NJ2315 - - 47 mm - - - - -
7028DB - - - - - - - -
7211BDB - - - - - - - -
NUP419 - - - - 140 mm - 105 mm -
7207BDF - - - - 161.5 mm - 119 mm9 mm
NJ2209E - - 47 mm0.6 - 4.7 mm - -
NUP2205E - - - - - - - -
4308 - - - - - - - -
6907-RS - - 70 mm - - - - -
7022DB - - - - 143 mm - - 19 mm
7206B - - - - - - 63.5 mm -
NJ303 - - - - 76 mm - - 7.5 mm
NN3009K - - - - - - - -
7815CDB - - - - - - 129 mm -
NUP421 - - - - - - - -
R22-ZZ - - - - - - - 7.5 mm
6018-Z - - - - 184 mm - - -
7209DT - - - - 70 mm - 50.8 mm14.3 mm
6917-2RS - - - - - - - -
7321 - - - - - - 116.5 mm -
7821CDF - - - - - - - -
QJ218 - - - - - - - -
NU209E - - - - - - - -
7906 - - - - - - - -
7012CDB - - - - 164 mm - 225 mm -
7818CDB - - - - 125 mm - - -
RLS12 - - - - 195 mm - - 25.4 mm
7918 - - - - - - - -
6817-ZZ - - - - 113 mm - - -
1641 - - - - - - - -
7926C - - - - - - - -
7315BDF - - - - - - - -
6915-RS - - - - 68 mm - - -
7305DF - - - - 117.5 mm - 95 mm -
7030DT - - - - 188 mm - 150 mm -
7321B - - - - - - - -
6819-2RZ - - - - 86 mm - - -
NUP418 - - - - - - - 12.7 mm
6811-2RS - - - - - - - -
1630-Z - - - - - - - -
7217CDT - - - - 166 mm - - -
16032 - - - - 135 mm - - 18.3 mm
NJ2318 - - - - - - - -
6010-ZZ - - - - - - - -
7920DT - - - - 120 mm - - -
6948-2RZ - - - - 94 mm - - 15.9 mm
6930-RZ - - - - 90 mm - - -
6830 - - - - - - - -
6218-ZZ - 105 mm - - - - - -
6902 - - - - 97 mm - - -
31322 - - - - - - - -
7314DF - - - - - - - -
4203 - - - - - - - -
7817CDB - - - - - - - -
6302 - - 52 mm - - - - -
7314 - - - - - - - -
7303BDT - - - - - - - -
W6206-2RSNR - - - - 115 mm - 157 mm -
87511 - - - - 274 mm - - -
7809CDT - - - - - - 95 mm6 mm
7014 - - - - 167 mm - 127 mm17.5 mm
6215-RS - - 40 mm - - - - -
7319B - - - - - - - 17.5 mm
6922-ZZ - - - - - - - -
7020CDF - - - - - - - -
6832-2RZ - - - - - - 130 mm -
7300 - - 160 mm - - 9.5 mm - 24.5 mm
NJ418 - - - - - - - -
7936DT - - - - - - - 17 mm
7212BDT - - - - 274 mm - - -
7201B - - - - - - - -
7310CDT - - - - - - 90 mm12.7 mm
NUP2304E - - - - - - - -
6918N - - - - - - - -
W210PPB9 - - - - - - - -
7212CDT - - - - - - - -
7026C - - - - - - - -
5208ZZ - - - - - - - -
NN3006K - - - - - - 76.5 mm6.5 mm
6300-2RS - - - - - - - -
7230CDT - - - - - - - -
N305E - - - - - - 90 mm -
NU218E - - - - - - - 30 mm
6-3305 - - 215 mm - - - - -
6918-RS - - - - - - - -
7028DF - - - - 180.5 mm - - -
6902-2RS - - - - 155 mm - 130 mm19 mm
6902-2RZ - - 85 mm - - 8 mm - 19 mm
7228BDF - - - - - - - -
6321-RS - - - - 116 mm - - -
7330BDF - - - - - - - -
32210 - - - - - - - -
DAC4582037 - - - - - - - 7 mm
NU221 - - - - - - 99 mm -
32224 - - - - - - - -
NF20820.75 mm - - - - - - -
33213 - - - - - - - 11.8 mm
6204-2RS - - - - 138 mm - 202 mm12 mm
7204DT - - - - 92 mm - - 17.5 mm
RLS18 - - - - - - - -
NU314E - - - - 122 mm - - 18.8 mm
NUP2217E - - - - - - - -
6938N - - - - - - - -
7030CDB - - 90 mm1.1 - 9 mm - 19 mm
33022 - - - - - - - -
6917-RS - - 42 mm - - - - -
W6305 - - - - - - - -
R24 - - - - - - - -
7321DF - - - - 111 mm - 148.5 mm21.4 mm
6844-RS - - - - - - 100 mm -
NUP313E - - - 1.1 - 6.5 mm - -
87501 - - - - - - - -
QUOTE

Gamet 210095/210170P bearing,210095/210170P Tapered

Jul 28, 2018 - 6915-ZZ, 75, 105, 16, CYSD, Deep Groove Ball Bearings. 7020 B, 100, 150, 24, ISO, Angular Contact Ball Bearings. 7076A, 380, 560, 82, NSK 
QUOTE

Appendix 1.xlsx - Dove Medical Press

cysD Z4060 ECs3606. 302 Purine metabolism ... ABC transporters. Membrane. 33,022. Yes No. 86. P0AFJ3. PHNA_ECO57. Protein phnA. phnA Z5710 
QUOTE

BioCyc -- EcoCyc Gene Links

... P69503 apt EG12030 EG12030 b2162 yeiK P33022 rihB EG10420 EG10420 ... EG10186 EG10186 b2752 895 P21156 cysD G7872 b4217 ytfK P0ADE2 ytfK 
QUOTE

Buy Bearing 33022 CYSD - Loyal Industrial

Buy Bearing 33022 CYSD from Loyal Industrial,Tapered Roller Bearings Distributor online Service suppliers
QUOTE

Co-complex - HiNT

... FHLA 16606699:0096:HT P0A6F5 P21156 GROL CYSD 16606699:0096:HT ... 16606699:0096:HT P0A948 P33022 RIMJ RIHB 16606699:0096:HT P0A948 
QUOTE

E. coli genes without cross-hybridization

... P33020 yeiI 2249720 2250808 b2162 CDS P33022 yeiK 2253206 2252265 ... cysN 2873442 2872015 b2752 CDS P21156 cysD 2874352 2873444 b2753 
QUOTE

110 mm x 170 mm x 45 mm CYSD NN3022K/W33 cylindrical

110 mm x 170 mm x 45 mm CYSD NN3022K/W33 cylindrical roller bearings ... 33022, 170 mm, 47 mm, -, -, 33 mm, 47 mm, 110 mm, 301 kN. 33022, 170 mm, 47 
QUOTE

FAG 33022 T2DE110 Bearing | Model:33022 T2DE110

❀❀❀FAG 33022 bearing,d 110 D 170 T 47 a 33 B 47 C 37 C a min 7 C b min 10 D a B 2750 Reference speed T2DE110 T2DE110 Comparative designation to 
QUOTE

110 mm x 170 mm x 45 mm CYSD NN3022/W33 cylindrical

Online 110 mm x 170 mm x 45 mm CYSD NN3022/W33 cylindrical roller bearings 110 mm x 170 ... 33022, 170 mm, 47 mm, -, -, 33 mm, 47 mm, 110 mm, 301 kN
QUOTE

Buy CYSD 33022 tapered roller bearings - BEARING SCIENCE

Manufacturers of all CYSD Bearings 17 Bearing I.D. d(mm) are represented in our partial list of clients. Contact Gary for a complete CYSD 33022 tapered roller 
QUOTE

110 mm x 170 mm x 45 mm CYSD NN3022/W33

110 mm x 170 mm x 45 mm CYSD NN3022/W33 Rodamientos De Rodillos con gráficos de ... 33022, 170 mm, 47 mm, -, -, 33 mm, 47 mm, 110 mm, 301 kN
QUOTE

Timken B-2020 Bearing | B-2020 Needle Roller Bearing | eB

CYSD - 7326BDF Bearing; SKF - 71908 CE/HCP4AH1 Bearing; IKO - NA ... 71425/71750 bearings delrin roller bearings , Model: 33022, Structure: Taper,Type: 
QUOTE

110 mm x 170 mm x 47 mm NTN 33022U Single row tapered

Welcome to the NTN 33022U Single row tapered roller bearings online seller ... Size (mm):200x250x24; Brand:CYSD; Basic dynamic load rating (C):74 kN;
QUOTE

Подшипник Timken X33022/Y33022 (110x170x47

Timken 33022. 2 предложения. Подробнее · 2 предложения · KOYO 33022JR ... CYSD 33022 · CYSD 33022 · Подробнее · CX 33022 A · CX 33022 A
QUOTE

E. coli knockout primers

... 67.5 aaggaaaaaa cgcacgcat potential PCR noise b2162 CDS P33022 yeiK 2 ... cysD 2 NotI SalI cacgcaataaccttcacactccaaatttataaccataaccgttcctttgcaatacc 
QUOTE

WebWx - METARs form results - RAP Real-Time Weather

CPXL 301000Z AUTO 32008KT 03/M02 RMK AO1 PK WND 33022/0937 T00341021 CPXL 300900Z AUTO 29009KT 04/M02 RMK AO1 PK WND 25019/0807 

110 mm x 170 mm x 47 mm  CYSD 33022 tapered roller bearings

110 mm x 170 mm x 47 mm CYSD 33022 tapered roller bearings Cad Models

Contact Us

Likao Bearing Co., Ltd.
AddressLiamonte 1034-Giso 66-1501 Buenos Aires, Argentina
Phone(Working Time)+54-44-6-654-8742
Fax
  • Likao Bearing Co., Ltd.
    • Quick question Quick question I'm very interested in your products; could you send me some detail reference information? Please send me detail product specification, thank you! May I be an agency of your products,and what's yourterms? We intend to purchase this product, would you please send me the quotation and minimum order quantity?
     This feature is Quick question function, select the corresponding question types, automatically enter the corresponding problem, remove your trouble of typing
Send Now

Related News

How can I make my skateboard bearings spin faster?
New bearings are slow when i spin them by hand. : NewSkatersThey ride ok, then again since im new i have no … Spin time/speed isn't everything; unlubricated and dry bearings spin the fastest, but will die the fastest How do you make ball...
How do you measure bearing temperature?
INTRODUCTION MONITORING TECHNIQUES FOR BEARINGSTemperature measurements have been widely used in the past to monitor the conditions within hydrodynamic journal and thrust bearings. These temperature  What's normal: The role of temperature...
How do you remove a pillow block bearing from a shaft?
What If There Was An Easier Way To Remove Bearings FromAug 13, 2018 — The Challenges of Bearing Removal. For hundreds of years, figuring out how to remove bearings from a shaft has been a time-consuming  US3883941A - Universal-type,...

Product Categories

  • FAG Bearing
  • Timken Bearing
  • NTN Bearing
  • KOYO Bearing
  • ISO Bearing
  • NACHI Bearing
  • NSK Bearing
  • INA Bearing
  • CYSD Bearing
  • FBJ Bearing
  • 608rs Bearing
  • 6202 Bearing
  • Abec 5 Bearings
  • bb30 Bearings
More

New Products

  • 12 mm x 32 mm x 12,7 mm CYSD 87501 deep groove ball bearings
  • 65 mm x 140 mm x 33 mm CYSD NUP313E cylindrical roller bearings
  • 220 mm x 270 mm x 24 mm CYSD 6844-RS deep groove ball bearings
  • 105 mm x 225 mm x 49 mm CYSD 7321DF angular contact ball bearings
  • 38,1 mm x 66,675 mm x 11,112 mm CYSD R24 deep groove ball bearings

Top Products

35 mm x 80 mm x 21 mm FBJ QJ307 angular contact ball bearings 140 mm x 300 mm x 102 mm FBJ 22328 spherical roller bearings 80 mm x 120 mm x 55 mm FBJ GE80ES plain bearings
12,7 mm x 28,575 mm x 7,938 mm FBJ 77R8 deep groove ball bearings Timken 204rr6 Bearing
  • About Us|
  • Contact Us|
  • Site Map
  • Sitemaps

Likao Bearing Co., Ltd.. Copyright © 2017 - 2023 All Rights Reserved.

  • Home
  • Product Categories
    • FAG Bearing
    • Timken Bearing
    • NTN Bearing
    • KOYO Bearing
    • ISO Bearing
    • NACHI Bearing
    • NSK Bearing
    • INA Bearing
    • CYSD Bearing
    • FBJ Bearing
    • 608rs Bearing
    • 6202 Bearing
    • Abec 5 Bearings
    • bb30 Bearings
  • Company Profile
    • Company Introduction
  • Technical Articles
  • Contact Us
Contact Us